Bùi hữu dũng bưỚC ĐẦU ĐÁnh giá TÌnh hình nhiễm circovirus trên vịt và khả NĂng nhiễm ghép giữA



tải về 1.26 Mb.
Chuyển đổi dữ liệu30.11.2017
Kích1.26 Mb.
#3388

BỘ GIÁO DỤC VÀ ĐÀO TẠO

TRƯỜNG ĐẠI HỌC NÔNG LÂM TP. HỒ CHÍ MINH

***************

BÙI HỮU DŨNG

BƯỚC ĐẦU ĐÁNH GIÁ TÌNH HÌNH NHIỄM CIRCOVIRUS TRÊN VỊT VÀ KHẢ NĂNG NHIỄM GHÉP GIỮA CIRCOVIRUSRIEMERELLA ANATIPESTIFER TRÊN VỊT SIÊU THỊT NHẬP NGOẠI Ở TỈNH ĐỒNG NAI
ĐỀ CƯƠNG LUẬN VĂN THẠC SỸ KHOA HỌC NÔNG NGHIỆP

Thành phố Hồ Chí Minh, tháng 9/2014


BỘ GIÁO DỤC VÀ ĐÀO TẠO

TRƯỜNG ĐẠI HỌC NÔNG LÂM TP. HỒ CHÍ MINH

***************



BÙI HỮU DŨNG

BƯỚC ĐẦU ĐÁNH GIÁ TÌNH HÌNH NHIỄM CIRCOVIRUS TRÊN VỊT VÀ KHẢ NĂNG NHIỄM GHÉP GIỮA CIRCOVIRUSRIEMERELLA ANATIPESTIFER TRÊN VỊT SIÊU THỊT NHẬP NGOẠI Ở TỈNH ĐỒNG NAI

Chuyên ngành: Thú Y

Mã số:
ĐỀ CƯƠNG LUẬN VĂN THẠC SỸ KHOA HỌC NÔNG NGHIỆP
Hướng dẫn Khoa học:

PGS.TS NGUYỄN TẤT TOÀN

TS. NGUYỄN THỊ PHƯỚC NINH

Thành phố Hồ Chí Minh

Tháng 5 /2015

MỤC LỤC

DANH SÁCH CÁC CHỮ VIẾT TẮT
AGP Agar Gel Pricipitin

AT Achilles Tedon

BFDV Beat feather disease virus

CAD Chick Edema Disease

DBH Dot-blot Hybridization

dNTP deoxyribonucleoside triphosphate

DHV Duck Hepatitis Virus

DNA Deoxyribo nucleotid acid

DuCV Duck circovrius

ELISA Enzyme linked immunosorbent Assay

GoCV Goose circovirus

HS Heart Sac

ISH In situ Hybridization

LAMP Loop-mediated isothermal amplification

M Meninges

OD Odd density

ORF Open reading Frame

pb Base pair

PBS Phosphate Bufferd Saline

PCV Porcine circovirus

PCR Polymera chain reaction

PiCV Piegon circovirus

PK15 Pig kiney 15

RA Riemerella anatipestifer

SC Subcutis

TBE Tris Borate EDTA


DANH SÁCH CÁC HÌNH
Hình 2.1 Các hạt phân tử DuCV ở túi bursa fabricius trên vịt Mulard được chụp dưới kính hiển vi điện tử

Hình 2.2 Cấu trúc bộ gien của DuCV

Hình 2.1 Vịt hư hại lông, chảy nước mắt, nước mũi

Hình 2.4 Vịt bị thất điều vận động, nằm ngửa và bơi chèo

Hình 2.5 Các bệnh tích đại thể phổ biến trên vịt nhiễm RA

Hình 2.6 Các bệnh tích vi thể phổ biến trên vịt nhiễm RA

DANH SÁCH CÁC BẢNG
Bảng 2.1 Một số kháng sinh và sulfamides sử dụng trong điều trị bệnh do RA

Bảng 3.1 Số lượng trại khảo sát và số mẫu dự kiến

Bảng 3.2 Mẫu thu thập cho các nghiên cứu xét nghiệm bệnh

Bảng 3. Trình tự đoạn mồi dùng trong phản ứng PCR chẩn đoán RA

Bảng 3. Thành phần phản ứng PCR trong chẩn đoán DuCV

Bảng 3. Chu trình luân nhiệt phản ứng PCR phát hiện RA



Chương 1

MỞ ĐẦU

1.1 Đặt vấn đề

Bệnh do Circovirus trên vịt có tỷ lệ lưu hành cao trên nhiều giống vịt nuôi nhà (Zhang và cs, 2012) như: Mulard, Super meat, Grimaud star 53... và được đặc trưng bởi tình trạng còi cọc và sự bất thường trong quá trình phát triển của bộ lông. DuCV được mô tả đầu tiên trong một trại vịt Mulard ở Đức năm 2003 (Hattermann và cs, 2003). Sau đó, sự lây nhiễm DuCV nhanh chóng được báo cáo ở nhiều quốc gia trên thế giới như: Hungary, Mỹ, Đài Loan và Trung Quốc (trích dẫn bởi Cha và cs, 2013). DuCV có thể là nguyên nhân gây suy giảm khả năng sinh sản và hiệu quả kinh tế chăn nuôi (Cha và cs, 2013). Đây là mối quan tâm rất lớn cho người chăn nuôi gia cầm hiện nay.

Rõ ràng, trong những năm gần đây, chăn nuôi gia cầm đang chiếm một vị trí ngày càng quan trọng trong sản xuất nông nghiệp. Trong đó, chăn nuôi vịt siêu thịt nhập ngoại đang là một trong những hướng phát triển mới cho người chăn nuôi. Một số giống vịt siêu thịt được nuôi nhiều ở tỉnh Đồng Nai như: Grimaud star 53, Super meat... đã và đang được phát triển một cách nhanh chóng. Tuy nhiên, các vấn đề quản lý và vệ sinh trong các trại chăn nuôi vịt còn quá nghèo nàn so với các trại gà. Hơn thế nữa, khả năng phổ cập kiến thức chăn nuôi cũng như hệ thống các cơ sở trang trại nuôi vịt không thể đáp ứng kịp thời và đầy đủ so với tốc độ phát triển đầu con. Đây được cho là một trong những nguyên nhân cơ bản làm cho tình hình dịch bệnh trong các cơ sở chăn nuôi vịt ngày càng diễn tiến phức tạp. Trong đó, bệnh do Circovrus trên vịt (DuCV) là một trong những nguy cơ đáng được lưu tâm.

Hầu hết, các nghiên cứu về DuCV thường tập trung vào các dấu hiệu lâm sàng, bệnh tích vi thể và ứng dụng một số phương pháp phân tử để chẩn đoán DuCV. Trong khi đó, khả năng nhiễm ghép giữa DuCV và các tác nhân khác cũng là một vấn đề đáng quan tâm đối với người chăn nuôi. Sự tổn thương các mô lympho là nguyên nhân gây suy giảm đáp ứng miễn dịch và làm tăng nguy cơ nhiễm ghép (Soike và cs, 2004).

Ở Việt Nam, chưa có nhiều báo cáo chính thống về tình hình lây nhiễm Circovirus trên vịt và khả năng nhiễm ghép với một số tác nhân khác như: E.coli, Salmonella, DHV và Riemeralla anatipestifer. Mặc dù, số lượng trại nuôi vịt siêu thịt nhập ngoại cũng đã tăng lên một cách nhanh chóng, cũng như tình hình dịch bệnh trên loài này cũng ngày càng phức tạp hơn.

Xuất phát từ những vấn đề thực tiễn sản xuất đặt ra, đề tài: “Bước đầu đánh giá tình hình nhiễm Circovirus trên vịt và khả năng nhiễm ghép giữa CircovirusRiemerella anatipestifer trên vịt siêu thịt nhập ngoại ở tỉnh Đồng Nai” đã được thực hiện dưới sự hướng dẫn của PGS.TS Nguyễn Tất Toàn và TS. Nguyễn Thị Phước Ninh.



1.2 Mục tiêu của đề tài

- Đánh giá tình hình nhiễm Circovirus trên đàn vịt nuôi.

- Đánh giá khả năng nhiễm ghép giữa CircovirusRA trên vịt.

1.3 Yêu cầu của đề tài

- Tỷ lệ nhiễm DuCV trên tổng đàn/ vịt khảo sát.

- Tỷ lệ nhiễm DuCV trên đàn/ vịt khảo sát theo lứa tuổi.

- Tỷ lệ nhiễm RA trên vịt dương tính với Circovirus.

- Tỷ lệ nhiễm RA trên vịt âm tính với Circovirus.

- So sánh tỷ lệ nhiễm RA trên vịt dương tính và âm tính với Circovirus.



Chương 2.

TỔNG QUAN TÀI LIỆU

2.1 Giới thiệu bệnh circovirus trên vịt

2.1.1 Lịch sử bệnh

Circovirus trên vịt (DuCV) thuộc giống Circovirus, họ Circoviridae được mô tả đầu tiên trên hai vịt mái Mulard 6 tuần tuổi ở Đức, năm 2003 (Hattermann và cs, 2003). Bệnh gây ra các tác hại chủ yếu như: rối loạn tình trạng mọc lông, chậm tăng trưởng và gầy ốm (Hattermann và cs, 2003; Soike và cs, 2004). Sau đó, DuCV cũng đã được phân lập ở Hungary (Fringuell và cs, 2005). Năm 2006, Chen và cs đã mô tả DuCV trên vịt Muscovy, Pekin và Mule với các triệu chứng còi cọc, sự bất bình thường trong quá trình phát triển của bộ lông trên vịt nuôi ở Đài Loan. Các phát hiện về bệnh Circovirus trên vịt cũng được mô tả ở Mỹ (Banda và cs, 2007) và Trung Quốc (Zhang và cs, 2009). Tháng 3 năm 2011, DuCV đã được phân lập trên đàn vịt Pockmuark thương phẩm ở Guangxi, Trung Quốc có các dấu hiệu lâm sàng của bệnh cùng với sự suy giảm đáp ứng miễn dịch (Liji Xie và cs, 2012).

Ở Việt Nam, chưa có nghiên cứu nào về DuCV được công bố chính thức.



2.1.2 Căn nguyên

Họ Circovirus gồm 2 giống: GyrovirusCircovirus. Trong khi Gyrovirus chỉ gây ra duy nhất bệnh thiếu máu trên gà - CAD (Hailemariam H., 2008), thì Circovirus có ít nhất 7 thành viên: Circovirus trên heo - PCV1, PCV2 (Allan và Ellis, 2000; Mankertz và cs, 2000), vi-rút gây bệnh mỏ và lông - BFDV (Bassami và cs, 2001), Circovirus trên bồ câu - PiCV (Mankertz và cs, 2000; Soike và cs, 2001; Todd và cs, 2002), Circovirus trên ngỗng - GoCV (Chen và cs, 2003; Soike và cs, 2004), Circovirus trên canary (Phenix và cs, 2001; Pringle, 1999) và Circovirus trên vịt - DuCV (Hattermann và cs, 2003).

DuCV có 20 mặt, không vỏ, dạng tròn, là một DNA sợi đơn, độ dài khoảng 1,99 kb (nucleotide 1988-1996), kích thước nhỏ, đường kính từ 15-16 nm (Hattermann và cs, 2003; Wang và cs, 2011). DuCV được chia thành 2 genotype: DuCV1, DuCV2 và 6 subtype gồm: 1a,1b,1c và 2a, 2b, 2c (Zhilong và cs, 2013).



Hình 2.1 Các hạt phân tử DuCV ở túi bursa fabricius trên vịt Mulard được chụp dưới kính hiển vi điện tử

(Nguồn: Soike và cs, 2004)

Theo Hattermann và cs (2003), DuCV có 2 khung đọc mở: ORF1 (ORF V1) và ORF2 (ORF V2). ORF1 còn gọi là gien Rep (nucleotide 33-926), nằm trên sợi vi-rút, mã hóa cho protein có trọng lượng 33,6 kDa, liên quan đến sự nhân lên của vi-rút. Gien Rep có sự bảo tồn cao, ít đột biến (Zhilong và cs, 2013). ORF2 còn gọi là gien Cap (nucleotide 1151-1924), nằm ở hướng đối diện, mã hóa cho protein capside liên quan đến cấu trúc và miễn dịch của vi-rút (Hattermann và cs, 2003; Liu và cs, 2010). Năm 2012, Xiang và cộng sự dựa trên cơ sở giải trình tự gien đã chứng minh DuCV có thêm ORF3 (nucleotide 103-399), nằm ở mạch bổ sung của ORF1 và có sự đồng nhất với gien ORF3 của PCV2 trên heo. ORF3 liên quan đến sự chết theo lập trình của tế bào. Tấc cả các ORF đều chịu áp lực chọn lọc codon.



Hình 2.2 Cấu trúc bộ gien của DuCV

(nguồn: Xiang, 2012)



2.1.3 Đặc điểm về dịch tễ

DuCV có tỷ lệ lưu hành cao trên vịt nuôi nhà (Zhilong Zhang và cs, 2013). Đã có nhiều báo cáo về tỷ lệ nhiễm Circovirus trên nhiều giống vịt như: Vịt Mulard, Muscovy, Mule, Cherry valley, Pekin và Pockmark (Banda và cs, 2007; Wan C. Và cs, 2011) ở nhiều nơi trên thế giới gồm: Đức, Mỹ, Hungary, Trung Quốc, Đài Loan (Liji và cs, 2014). DuCV có thể truyền ngang (Lin và cs, 2010) và truyền dọc từ đàn vịt giống sang vịt con tại cùng một thời gian ( Li và cs, 2014). Các nghiên cứu của Hattermann và cs (2003) trên vịt mái 6 đến 8 tuần tuổi đã mô tả các triệu chứng đặc trưng của bệnh (Soike và cs, 2004). Sự suy giảm miễn dịch làm tăng khả năng đồng nhiễm một số tác nhân gây bệnh khác như: Riemerella anatipestifer, Pasteurella multocida, Staphilococus aureus, Duck hepatitisAspergillus fumigatus (Soike và cs, 2004; Fringuelli và cs, 2005; Chen và cs, 2006; Zhang và cs, 2009). Sự nhiễm ghép của các tác nhân này với Circovirus có tỷ lệ lưu hành cao trên cả gia cầm non và gia cầm trưởng thành (Leslie Và Kenneth, 2013). Tỷ lệ mắc bệnh cao đã được mô tả Trung Quốc nhưng các quốc gia liền kề như: Hàn Quốc, Nhật Bản thì chưa có báo cáo về tình trạng này (Cha và cs, 2014).

Các nghiên cứu của Ritchie và cộng sự (1991); Rittchie và Latimer (1995) đã chứng minh Circovirus tồn tại trong các chất bài tiết, phân của những con vẹt bị nhiễm bệnh và bụi trong không khí. Nghiên cứu cũng đề nghị rằng: sự bài thải các hạt vi-rút và sự tiêu hóa trực tiếp các vật nhiễm bệnh có thể là con đường truyền lây tự nhiên của vi-rút. Hess (2004) cũng đã chứng minh: vi-rút được phát hiện phổ biến trên lớp sừng của nang lông, đây có thế là nơi vi-rút tồn tại và bài thải mầm bệnh ra môi trường.Tuy nhiên, các nghiên cứu trên vịt vẫn chưa được biết rõ. Ngoài ra, Circovirus còn tồn tại ở gan (Eisenberg và cs, 2003), lách, thận và các cơ quan đường hô hấp (khí quản, họng và phổi) (Duchatel và cs, 2006).

2.1.4 Sự miễn dịch

ORF2 (Protein capsid) mã hóa protein cấu trúc và độc lực của vi-rút, liên quan đến đáp ứng miễn dịch của vật chủ (Hattermann và cs, 2003).

Miễn dịch chủ động: Khi gia cầm nhiễm Circovirus, đáp ứng miễn dịch được hình thành, cho kết quả huyết thanh học dương tính (Ritchie, 1992; Raidal, 1993; Raidal và Cross, 1994). Gia cầm khỏe mạnh tiếp xúc với Circovirus có titers cao hơn khi được gây nhiễm chủ động. Như vậy, kháng thể bảo vệ có khả năng chống lại sự xâm nhiễm của vi-rút, làm giảm các dấu hiệu lâm sàng của bệnh. Nghiên cứu cũng chứng minh rằng: tỷ lệ lưu hành của PCR dương tính với Circovirus vượt trội hơn so với tỷ lệ lưu hành huyết thanh dương tính trên những con ngỗng con. Nguyên nhân có thể do sự thiếu nhạy cảm của các test huyết thanh học hoặc sự suy giảm đáp ứng miễn dịch do ảnh hưởng của Circovirus đến hệ miễn dịch của cơ thể (Biagini, 2011; Scott và cs, 2006). Theo Scott và cộng sự (2006), kháng thể được phát hiện đầu tiên trên ngỗng gây bệnh thí nghiệm là 27 ngày tuổi và 53 ngày tuổi đối với ngỗng nhiễm bệnh tự nhiên.

Miễn dịch bị động: Những cá thể gà được tiêm vắc-xin vẫn xuất hiện các dấu hiệu lâm sàng của bệnh khi nhiễm Circovirus. Ngược lại, những cá thể không được tiêm vắc-xin vẫn có khả năng chống lại Circovirus khi được gây nhiễm với một lượng vi-rút như nhau. Qua đó cho thấy, gia cầm được gây nhiễm Circovirus chết có thể truyền kháng thể bảo vệ cho gà con (Jeurissen và cs, 1992; Jeurissen và Boer, 1993). Khả năng đáp ứng miễn dịch chéo không xảy ra đối với các vật chủ khác nhau khi tiếp xúc Circovirus. Tuy nhiên cần có những nghiên cứu cụ thể hơn về khả năng đáp ứng miễn dịch đối với Circovirus trên vịt.



2.1.5 Sự nhân lên của Circovirus

Do khó khăn trong việc nhân giống Circovirus trong nuôi cấy tế bào hoặc phôi gà nên sự hiểu biết về sự nhân lên của Circovirus còn rất hạn chế. Có 2 loài thuộc họ Circoviridae gồm: CIAV ( Chicken infectious anaemia virus) và PCV (Porcine circovirus) được nhân giống trong môi trường nuôi cấy tế bào (Murphy và cs, 1999; Todd và cs, 2001) và đã có những thông tin cơ bản về sự nhân lên của vi-rút. CIAV nhân lên trong tế bào MDCC-MSB1 bắt nguồn từ tế bào lympho của bệnh Marek, còn PCV phát triển trong tế bào PK15. Do sự giới hạn về kích cỡ của bộ gen nên khả năng nhân lên của Circovirus phụ thuộc nhiều vào các enzymes trong tế bào. Circovirus nhân lên trong nhân và phụ thuộc vào protein tế bào được tạo ra trong suốt pha S của chu kỳ tế bào (Todd và cs, 2001). Các quá trình nguyên phân cần thiết cho DNA đi vào trong nhân và sự nhân lên xảy ra trong các tế bào đích như: biểu mô nang lông, các lympho bào và biểu mô đường ruột. Sự nhân lên xảy ra trên cấu trúc stem-loop của bộ gien, ORF1 mã hóa protein cần thiết cho sự nhân lên của vi-rút (Mankertz và cs, 2000; Todd và cs, 2001).



2.1.6 Triệu chứng lâm sàng

Các triệu chứng lâm sàng của vịt nhiễm Circovirus thường không điển hình, không có những biểu hiện bất thường đặc trưng. Vịt chết rãi rác và chậm lớn. Theo Hattermann và cộng sự (2003), vịt chủ yếu còi cọc, thể trạng kém và hư hại bộ lông dọc theo sống lưng. Một số con có thể bị xuất huyết ở gốc chân lông. Tình trạng này cũng được quan sát thấy trên chim sẻ, quạ và ngỗng bị nhiễm Circovirus (Leslie và Kenneth, 2013). DuCV có thể nhiễm ghép với nhiều tác nhân khác như: E.coli, P. Multocida, Riemerella anatipestifer, viêm gan vịt (theo trích dẫn của Xiang và cs, 2012) và làm ảnh hưởng nghiêm trọng đến hiệu quả chăn nuôi (Se-Yeoun và cs, 2014). Nhiễm ghép cũng xảy ra phổ biến trên vịt lớn tuổi và sự suy giảm đáp ứng miễn dịch do tác động của Circovirus được cho là nguyên nhân cơ bản (Banda và cs, 2007).



2.1.7 Bệnh tích

Các nghiên cứu chủ yếu tập trung vào các biến đổi bệnh tích vi thể trên vịt bị nhiễm Circovirus. Phức hợp bệnh tích mô bào, sự hoại tử xảy ra ở lách, tuyến ức và túi bursa fabricius (Liu và cs, 2010). Ngoài ra, sự viêm và hoại tử cũng xảy ra rất phổ biến trên lông bị loạn dưỡng (teo) ở vịt nhiễm Circovirus (Soike và cs, 2004). Các điểm hoại tử phân tán được thấy trong biểu mô chân lông nhưng không thấy xuất huyết ở tủy chân lông. Các tế bào viêm bị xâm nhiễm nhiều bạch cầu trung tính và bạch cầu đơn nhân. Nang lông và biểu mô quanh nang lông ở vùng da dọc sống lưng xâm nhiễm nhiều tế bào viêm bắt màu lưỡng tính (Soike và cs, 2004). Các thể vùi trong nhân bắt màu lưỡng tính cũng được tìm thấy trong các tế bào biểu mô lông hoặc nang lông (Latimer và cs, 1991). Ngược lại, các thể vùi dạng chùm nho hoặc hình que đã được mô tả trong các đại thực bào ở biểu mô lông, nang và ống lông.

Ở túi fabricius, bệnh tích vi thể chủ yếu là sự cạn kiệt các lympho bào, sự hoại tử và gây bệnh tích mô bào (Soike và cs, 2004). Tuy nhiên, Fringuelli và cộng sự (2005) lại cho rằng: sự hiện diện của các đám thể vùi trong nhân tế bào có thể không phải là đặc trưng phổ biến của Circovirus trên vịt.

2.1.8 Chẩn đoán

Do chưa có môi trường nuôi cấy để phân lập DuCV trong phòng thí nghiệm nên hầu hết các chẩn đoán DuCV phụ thuộc vào các kỹ thuật phân tử (Fringuellie và cs, 2005). Các kỹ thuật PCR truyền thống và DBH đã được Todd (2002) sử dụng để chẩn đoán Circovirus. Ngoài ra, một số kỹ thuật phân tử khác như: real time PCR (Fringuelli và cs, 2005), nested PCR (Halami và cs, 2008) và ISH cũng đã được phát triển để phát hiện DuCV. Theo Wan và cộng sự (2011), nested PCR và ISH nhạy cảm hơn so với PCR truyền thống. Nhưng nested PCR yêu cầu phải phân tích trên gel agarose để phát hiện sản phẩm khuyếch đại và có nguy cơ tạp nhiễm cao hơn. Trong khi đó, ISH cần nhiều thời gian để thực hiện. Tuy nhiên, các phương pháp này không được sử dụng để phân biệt các serotype DuCV1 và DuCV2. Năm 2014, Li và cộng sự đã ứng dụng kỹ thuật duplex PCR - có độ đặc hiệu và độ nhạy cao - để chẩn đoán phân biệt hai serotypes này. Sau đó, kỹ thuật LAMP cũng được ứng dụng như một kỹ thuật chẩn đoán nhanh và trực tiếp trên các mẫu lâm sàng trong chẩn đoán DuCV.

Phương pháp ELISA gián tiếp đã được Liu và cộng sự (2010) sử dụng để phát hiện Circovirus trên vịt và điều tra dịch tễ của bệnh. Tác giả sử dụng kháng nguyên protein capside tái tổ hợp của DuCV được sản xuất từ các tế bào E.coli để phát hiện kháng thể đặc hiệu của Circovirus trong huyết thanh vịt.

2.2 Giới thiệu bệnh bại huyết do Riemerella anatipestifer (RA) trên vịt

Bệnh do RA là một bệnh truyền nhiễm cấp tính trên vịt, ngỗng, gà tây và nhiều loài gia cầm nuôi nhà khác. Bệnh được biết đến với nhiều tên gọi khác nhau như: bệnh bại huyết trên vịt, hội chứng anatipestifer, bệnh bại huyết do anatipestifer hay bệnh viêm thanh mạc truyền nhiễm. Bệnh xảy ra cấp tính hoặc mãn tính với các đặc trưng như: viêm màng ngoài tim, màng bao gan, viêm túi khí, viêm vòi trứng tích casein và viêm màng não.

Bệnh gây thiệt hại lớn về kinh tế do có tỷ lệ tử vong cao, tăng trọng kém. Vì vậy, cần phải kết hợp đồng thời nhiều biện pháp để ngăn ngừa và kiểm soát bệnh như: chẩn đoán bệnh chính xác, kịp thời, chủng ngừa vắc-xin và điều trị bệnh.

RA được mô tả đầu tiên năm 1932 trên vịt Bắc Kinh từ ba trại vịt ở Long island, New York. Hendrickson và Hilbert (1932) đã phân lập được mầm bệnh và lấy tên Pfeifferella anatipestifer. Sau đó, tác nhân gây bệnh đã được phân lập dựa trên các đặc tính và liên tiếp được thay đổi tên từ Moraxella anatipestifer (Brogden, Rhoades và Rimler, 1982), Flavobacterium (Piechulla, Pohl và Mannheim, 1986), Pasteurella anatipestifer. Cuối cùng, Segers và cộng sự (1993) đã quyết định đặt tên là Riemerrella anatipestifer thuộc họ Flavobacteriaceae để tưởng nhớ Riemer (Riemer, 1904) - người đầu tiên mô tả bệnh bại huyết tiết dịch trên ngỗng năm 1904.



2.2.1 Căn nguyên

RA có dạng trực khuẩn, Gram âm, hiếu khí, không di động, không bào tử và có thể kết nhóm đôi hay chuỗi ngắn. RA có kích thước 1-2 mm, dạng lồi, mọc thành khối, trong suốt và óng ánh.

RA được định serotype dựa vào phản ứng trung hòa và phản ứng AGP. Cả hai test này đều liên quan đến kháng nguyên bề mặt (Brogden, 1982). Có 21 serotype (từ serotype 1 đến serotype 21) đã được báo cáo. Tấc cả các serotype đều phản ứng đặc hiệu với kháng huyết thanh, ngoại trừ serotype 5 có phản ứng chéo với serotype 2 và serotye 9 (Loh và cs, 1992; Sandhu và Harry, 1981). Subramaniam và cộng sự (2000), đã chèn gien protein màng (Omp A) của RA để mã hóa protein màng kháng nguyên đặc hiệu (42 kDa). Tấc cả các chủng của RA đều chứa gien Omp A, mặc dù, một vài sự khác biệt về gien cũng đã được quan sát trên các chủng khác nhau. Hu và cộng sự (2011) đã chứng minh Omp A là yếu tố độc lực của RA. Hầu hết các chủng RA đều chứa plasmids (3,9 b) mang các gien protein. (thêm hình cấu trúc RA)

2.2.2 Đặc điểm nuôi cấy

RA phát triển tốt trong môi trường thạch chocolate, thạch máu và trypticase soy agar. Để RA phát triển tốt cần bổ sung thêm 0,05 % chiết xuất men bia và 5 % huyết thanh bê con mới sinh. Sự phát triển của RA sẽ tốt hơn nếu tăng thêm carbon dioxide (Graham, 1938). Vi sinh vật phát triển tối ưu sau 48-72 giờ nuôi cấy ở 37 0C trong bình nuôi cấy khi được cung cấp đầy đủ carbon dioxide và ẩm độ. RA không phát triển ở nhiệt độ quá 55 0C hoặc dưới 4 0C.



2.2.3 Sức đề kháng

Hầu hết các chủng RA không sống sót trong môi trường rắn (solid media) quá 3-4 ngày ở 37 0C hoặc nhiệt độ phòng, 12-16 giờ ở 55 0C (Bangun và cs, 1981). Ngược lại, RA có thể tồn tại 2-3 tuần ở nhiệt độ 4 0C trong môi trường nước luộc thịt. RA nhạy cảm với một số kháng sinh như: penicillin, novobiocin, chloramphenicol, lincomycin, enrofloxacin, ceftiofur, streptomycin, erythromycin, ampicillin, bacitracin, neomycin và tetracycline nhưng rất đề kháng với kanamycin, polymyxin (Bangun và cs, 1981; Chang, 2003) và gentamycin.



2.2.4 Đặc điểm dịch tễ

Bệnh do RA xảy ra trên toàn thế giới và được công bố ở trên nhiều quốc gia có nền chăn nuôi vịt thâm canh. Sự phức tạp của căn bệnh phụ thuộc vào nhiều yếu tố như: chủng vi khuẩn, tuổi của vật chủ và đường truyền lây (Heddleston, 1972; Sarver và 2005). RA được mô tả đầu tiên trên vịt và ngỗng. Sau đó, được báo cáo trên gà tây (Sarver, 1977; Zehr, 1970), chim trĩ (Bruner, 1970), gà (Rosenfeld, 1973), cút (Pascucci, 1989) và heo (Hinz, 1998).

Vịt từ 1-8 tuần tuổi nhạy cảm cao với mầm bệnh. Vịt nhỏ hơn 5 tuần tuổi thường chết trong 1-2 ngày sau khi xuất hiện các triệu chứng lâm sàng. Tuổi vịt lớn hơn thường có thời gian sống sót lâu hơn. Bệnh do RA hiếm khi xảy ra trên vịt đẻ.

Mầm bệnh truyền lây trực tiếp và gián tiếp. RA truyền lây trực tiếp qua đường hô hấp (Layton, 1984), gián tiếp qua các vết thương trên da thông qua trung gian các chất độn chuồng nhiễm mầm bệnh (Asplin, 1955). Vi khuẩn xâm nhập qua các vết trầy xước, vết nứt hay các vết thương trên da hoặc các điểm ở cánh. Vịt cũng có thể bị nhiễm mầm bệnh qua phân vào thức ăn, nước uống hay môi trường, nơi vịt nhiễm RA mãn tính là nguồn lây bệnh lâu dài trong trại. Thời gian ủ bệnh thường từ 2-5 ngày. Sự gây nhiễm thí nghiệm bằng cách tiêm dưới da hoặc trong da có biểu hiện lâm sàng đặc trưng của bệnh, tỷ lệ tử vong cao và sớm sau 24 giờ. Ngược lại, gây nhiễm qua đường miệng hoặc hô hấp thì tỷ lệ tử vong thấp hơn (Asplin, 1956; Hatfield, 1988; Sarver, 2005).



2.2.5 Triệu chứng lâm sàng

Các dấu hiệu lâm sàng thường được quan sát thấy với các biểu hiện: ủ rũ, chảy nước mắt, nước mũi, ho, hắc hơi, sốt và thở nhanh. Vịt tiêu chảy phân xanh. Ngoài ra, vịt còn bị thất điều vận động, bơi chèo, quẹo cổ, run đầu và hôn mê. Vịt chết do nhiễm trùng huyết và nhiễm độc tố huyết. Tùy thuộc vào đặc tính gây bệnh của vi khuẩn, tỷ lệ bệnh biến động từ 5-75 %, tỷ lệ chết thường cao hơn. Những con vịt sống sót thường còi cọc hay chậm lớn (Pickrell, 1966).







Hình 2.3 Vịt hư hại lông, chảy nước mắt, nước mũi.

(http://vemedim.vn/Download/Benh_Bai_Huyet_Tren_Vit.pdf)



Hình 2.4 Vịt bị thất điều vận động, nằm ngửa và bơi chèo.
(http://poultrypics.com/?page_id=446)


2.2.6 Bệnh tích

2.2.6.1 Bệnh tích đại thể

Các tổn thương đại thể chủ yếu là sự tiết dịch có sợi huyết trên một số cơ quan như: tim, gan hay túi khí. Tình trạng viêm bao tim và có dịch thẩm xuất biểu hiện qua tình trạng: bao tim trắng đục lúc mới phát, ở giai đoạn sau, bao tim khô có nhiều sợi huyết. Các tổn thương thường kết hợp với xuất huyết lấm tấm. Gan bị viêm được bao phủ bởi một lớp trắng đục và không bám dính vào các cơ quan khác. Lách phì đại trung bình, dạng dài ra, hơi mất màu và bề mặt có dạng đá hoa cương. Ở thể thần kinh, vịt bị viêm màng não có sợi huyết. Đường đi của mạch nổi lên và thường biểu hiện rõ ở vùng phù nề. Ở giai đoạn cuối, tấc cả các cơ quan nội tạng đều được bao phủ bởi lớp sợi huyết. Ngoài ra, có thể gặp tình trạng viêm khớp có mủ trên vịt bệnh.





Hình 2.5 Các bệnh tích đại thể phổ biến trên vịt nhiễm RA

(a) Viêm màng bao tim, tích fibrin

(b) Viêm màng bao gan

(c) Túi khí viêm dày đục và xuất huyết

(d) Viêm xuất huyết khớp chân

(e) Lách sưng, bề mặt như đóa hoa cương

(Nguồn: Hess và cs, 2013)

2.2.6.2 Bệnh tích vi thể

Bao tim tích dịch có sợi huyết chứa một số tế bào viêm, các tế bào đơn nhân và bạch cầu trung tính. Ở thể quá cấp, mô cơ tim bị hoại tử điểm nghiêm trọng. Ở mô gan, có sự xâm lấn nhẹ các bạch cầu đơn nhân ở rìa và sự thoái hoái các tế bao nhu mô. Ở thể cấp tính, sự xâm lấn các tế bào bạch cầu ở rìa cũng có thể được quan sát thấy (Pickrell, 1966). Ở túi khí, các tế bào đơn nhân chiếm đa số trong dịch tiết. Trong khi đó, các tế bào đa nhân khổng lồ và các nguyên sợi bào có thể được quan sát thấy ở thể mãn tính (Dougherty, 1955). Đường hô hấp cũng bị nhiễm RA nhưng không có biểu hiện lâm sàng. Phổi có thể không bị ảnh hưởng. Chỉ có sự xâm lấn nhẹ các tế bào và sự gia tăng nhanh chóng các nốt lympho gần tiểu phế quản (Pickrell, 1966) hoặc viêm phổi tiết dịch sợi huyết có mủ (Graham, 1938). Hệ thống thần kinh trung ương có thể tạo sợi huyết và viêm màng não với sự xâm lấn các tế bào lympho ở trong hoặc xung quanh mạch máu não (Jortner và cs, 1969). Sự hoại tử các mô lympho và sự suy kiệt các lympho bào cũng được mô tả ở lách và túi bursa fabricius (Sarver, 2005).





Hình 2.6 Các bệnh tích vi thể phổ biến trên vịt nhiễm RA

(a) Màng bao tim lấp đầy tế bào đơn nhân và các bạch cầu hạt bắt màu lưỡng tính

(b) Viêm màng não lấp đầy tế bào viêm

(c) Viêm vùng mô dưới da lấp đầy bạch cầu trung tính

(d) Các tế bào đơn nhân và bạch cầu hạt nhuộm màu lưỡng cực ở vùng gân gót Asin

(Nguồn: Hess và cs, 2013)

2.2.7 Chẩn đoán

Phân lập và xác định RA: Hầu hết vi khuẩn có thể được phân lập nhanh để chẩn đoán bệnh trong trường hợp bệnh cấp tính. Các mẫu mô thường được sử dụng gồm: não, máu tim, túi khí, tủy xương, phổi, gan và dịch tiết các tổn thương. Các phản ứng trung hòa và phản ứng AGP cũng được sử dụng để xác định các serotype của RA với kháng huyết thanh đặc hiệu. Thử phản ứng sinh hóa cũng là một trong những phương pháp chẩn đoán phổ biến. Ngoài ra, các phản ứng phân tử cũng được sử dụng để xác định các chủng RA và nghiên cứu về dịch tễ của bệnh như: PCR (Christensen, 2010; Yu, 2008), multiplex PCR (Hu, 2011), LAMP (Han, 2011; Zheng, 2011).

Chẩn đoán huyết thanh học: Phản ứng miễn dịch huỳnh quang có thể được sử dụng để xác định RA trong mẫu mô bệnh hoặc dịch tiết từ vịt bệnh (Marshall, 1961). Phản ứng ngưng kết và ELISA có thể được sử dụng để phát hiện kháng thể trong huyết thanh. ELISA thì nhạy hơn so với phản ứng ngưng kết (Hatfield, 1987; Lobbedey, 2003).

2.2.8 Chẩn đoán phân biệt

RA nên được chẩn đoán phân biệt với các bệnh gây nhiễm trùng huyết khác như: P.multocida, E.coli, Salmonella, Streptococcus faecium. Nếu chỉ dựa vào triệu chứng và bệnh tích đại thể rất khó để chẩn đoán phân biệt được các bệnh này, cần phải phân lập và xác định căn nguyên gây bệnh chính xác.



2.2.9 Phòng và điều trị

Những vấn đề quan trọng nhất trong việc ngăn ngừa RA là thực hiện an toàn sinh học, quản lý và thực hành vệ sinh trong chăn nuôi. Chuồng trại thông thoáng, giảm các yếu tố có nguy cơ gây stress cao như mật độ đông đúc, nhiệt độ quá nóng hoặc quá lạnh. Nền hoặc sàn nuôi, các dụng cụ thiết bị cần được vệ sinh định kỳ...

Hiện nay, có cả hai loại vắc-xin được sử dụng để phòng bệnh do RA trên vịt, bao gồm: vắc-xin chết và vắc-sống nhược độc. Vắc-xin chết có thể ngăn ngừa và làm giảm tỷ lệ tử vong do RA (Harry, 1979; Layton, 1984; Sandhu, 1979). Vắc-xin chết chứa serotype 1, 2 và 5 được sử dụng ở Mỹ và Canada. Vịt con được chủng vắc-xin lúc 2-3 tuần tuổi cho đáp ứng miễn dịch bảo vệ đến khi xuất thịt (Layton, 1984). Trong khi đó, vắc-xin sống chứa serotype 1, 2 và 5 cũng đã được sử dụng cho vịt 1 ngày tuổi bằng cách phun sương hoặc cho uống (Sandhu, 1991). Miễn dịch có thể bảo vệ vịt tới 42 ngày tuổi. Vịt đẻ có thể sử dụng cả vắc-xin sống và vắc-xin chết để tạo đáp ứng miễn dịch cho vịt con đến 2-3 tuần tuổi thông qua kháng thể mẹ truyền (Sandhu, 1992). Tuy nhiên, ở Việt Nam vẫn chưa có vắc-xin phòng bệnh do RA trên vịt.

Sự đề kháng kháng sinh của RA thay đổi theo thời gian (Zhong, 2009). Kháng sinh và các sulfamides là những hoạt chất được chứng minh có tác dụng tốt trong điều trị bệnh do RA (bảng ...)



Bảng 2.1 Một số kháng sinh và sulfamides sử dụng trong điều trị bệnh do RA

Tên

Hàm lượng hoặc liều sử dụng

Đường cấp thuốc

Sulfamethazine

0,2-0,25%

Uống hoặc trộn thức ăn

Sulfaquinoxaline

0,025-0,05%

Trộn thức ăn

Novobiocin

0,0303-0,0368%

Trộn thức ăn

Lincomycin

0,011-0,022%

Trộn thức ăn

Penicillin




Tiêm dưới da

Enrofloxacin

50 ppm ngày đầu tiên và 25 ppm 4 ngày tiếp theo

Pha nước uống

Ceftiofur

2 mg/kgP

Tiêm dưới da

Sulfadimethoxine + Ormetoprim

0,02-0,12%

Trộn thức ăn

Penicillin + Streptomycin




Tiêm dưới da

Lincomycin + Spectinomycin




Tiêm dưới da

(theo Ruiz và Sandhu, 2013)

Mức độ đề kháng cao với RA trên một số kháng sinh đã được chứng minh với các tỷ lệ lần lượt gồm: oxacillin (88,6 %), penicillin G (86,9 %), sulfamethoxazole/trimethoprim (79,2 %), ceftazidime (75,9 %). Mức độ đề kháng thấp hơn ở amikacin (9,5 %), neomycin (9,5 %).



2.4 Các công trình nghiên cứu về Circovirus ở vịt trên thế giới và Việt Nam

Sau khi Hattermann và cộng sự (2003) đã có những mô tả đầu tiên về các đặc điểm, hình thái, cấu trúc của Circovirus trên hai vịt mái Mulard 6 tuần tuổi ở Đức. Hàng loạt các nghiên cứu về triệu chứng, bệnh tích mà đặt biệt là các phương pháp chẩn đoán bệnh do Circovirus góp phần làm sáng tỏ và chẩn đoán nhanh mầm bệnh. Những nghiên cứu đó, đóng góp chung vào việc phòng và chống bệnh hiệu quả, đem lại lợi ích to lớn cho ngành chăn nuôi và công tác thú y trên thế giới.

Fringuelli và cộng sự (2005) đã ứng dụng phương pháp PCR truyền thống và real time PCR trong chẩn đoán DuCV. Kết quả cho thấy, DNA DuCV được phát hiện ở 85/104 mẫu fabricius (84 %) từ mẫu vịt bệnh hoặc chết ở lứa tuổi 1 đến 12 tuần tuổi và 35/37 trại (94 %) dương tính với DuCV. Ngoài ra, tác giả cũng đánh giá phương pháp real time PCR có độ nhạy cao hơn so với phương pháp PCR truyền thống.

Jiang và cộng sự (2008) báo cáo: đã sử dụng phương pháp PCR để phát hiện và giải trình tự gien của DuCV trên vịt Muscovy bệnh ở tỉnh Fujian , Trung Quốc. Theo đó, tỷ lệ mẫu dương tính là 79 %, có 10/12 trại dương tính với DuCV. Tác giả sử dụng phương pháp PCR để giải trình tự gien cho biết tỷ lệ tương đồng của DuCV được phân lập ở tỉnh Fujian (FJ0601) là 97,3-97,5 % so với 4 chủng được phân lập Đài Loan (TC1/2002, TC2/2002, TC3/2002, TC4/2002), 82,9 % so với chủng được phân lập ở Mỹ và 82,3 % chủng được phân lập ở Đức. Phân tích trình tự gien của DuCV cho thấy genome hoàn chỉnh có độ dài 1988 bp.

Sự nhiễm ghép của DuCV với các tác nhân khác như: E.Coli, P. multacida, Riemerella anatipestifer hay viêm gan vịt đã được mô tả. Các nghiên cứu của Zhang và cộng sự (2009) đã sử dụng phương pháp PCR để điều tra tỷ lệ nhiễm ghép của DuCV với RA, E.coli và DHV1 trên vịt Cherry Valley ở tỉnh Shangdong, Trung Quốc. Theo đó, tỷ lệ vịt chỉ nhiễm DuCV là 33,29%. So sánh tỷ lệ vịt dương tính và âm tính với DuCV khi nhiễm ghép với RA lần lượt là: 23,4 % và 8,28 %; với E.coli là 16,19 % và 4,85 % và DHV1 là: 25,5 % và 7,47 %.

Sau đó, Cha và cộng sự (2012) cũng đã đánh giá tỷ lệ nhiễm ghép giữa DuCV với RA và Salmonella trên vịt được nuôi ở Hàn Quốc. Tỷ lệ vịt chỉ nhiễm Circovirus là 10,9 %. Trong khi đó, tỷ lệ nhiễm ghép giữa DuCV với RA, Salmonella hay DuCV với RA và Salmonella lần lượt là: 4,1 %, 5 % hay 1,4 %.

Chúng tôi nhận thấy trên thế giới đã có nhiều công trình nghiên cứu về các đặc điểm của bệnh cũng như vi-rút gây bệnh, trong đó, có các công trình về chẩn đoán DuCV. Nhưng tại Việt Nam chưa có nhiều mô tả về bệnh, sự đánh giá về khả năng nhiễm ghép giữa DuCV và các tác nhân khác, cũng như ứng dụng phương pháp PCR trong chẩn đoán nhanh DuCV.

Chương 3

NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU

3.1 Thời gian và địa điểm

Đề tài nghiên cứu được tiến hành từ tháng 05/2015 đến tháng 05/2016 trên các trại vịt siêu thịt nhập ngoại thuộc các huyện Trảng Bom, Thống Nhất và Gia Kiệm, tỉnh Đồng Nai. Các xét nghiệm mẫu bệnh phẩm được thực hiện tại phòng Bệnh lý, xét nghiệm PCR tại phòng xét nghiệm PCR, Bệnh viện Thú y - Khoa Chăn nuôi Thú y, trường đại học Nông Lâm TP.HCM.



3.2 Đối tượng nghiên cứu

Vịt siêu thịt nhập ngoại ở các lứa tuổi: vịt Grimaud star (Pháp), vịt Super Meat...

Bệnh do Circovirus và bệnh bại huyết do Riemerella anatipestifer trên vịt.

3.3 Nội dung nghiên cứu

Luận văn có 2 nội dung nghiên cứu chính:

- Đánh giá sự lưu hành của DuCV trên đàn vịt nuôi.

- Đánh giá mức độ đồng nhiễm giữa DuCV với RA trên vịt.



3.4 Phương pháp và vật liệu nghiên cứu

3.4.1 Đánh giá sự lưu hành của DuCV trên đàn vịt nuôi

3.4.1.1 Phương pháp quan sát, thống kê

Chúng tôi tiến hành điều tra thu thập thông tin trại theo phương pháp cắt ngang, một số thông tin theo phương pháp hồi cứu từ các chủ trại hoặc kỹ thuật viên chính. Vịt nhiễm Circovirus thường không có biểu hiện lâm sàng đặc trưng. Do đó, chúng tôi lựa chọn ngẫu nhiên những con vịt chết rãi rác (không quá 5 giờ) và một số lượng nhỏ vịt có biểu hiện chậm lớn, còi cọc hoặc bất bình thường trong sự phát triển của bộ lông (xơ xác, chậm mọc lông hoặc hư hại vùng lông dọc sống lưng). Các dữ liệu được chúng tôi thu thập và thống kê theo mẫu điều tra (xem phụ lục 1).



3.4.1.2 Phương pháp bố trí thu thập vịt và phương pháp mổ khám

* Bố trí điều tra và lấy mẫu: Chúng tôi bố trí thu thập vịt để mổ khám theo phương pháp lấy mẫu ngẫu nhiên ở 3 huyện: Trảng Bom, Thống Nhất và Gia Kiệm, tỉnh Đồng Nai. Số lượng trại khảo sát và số mẫu dự kiến như sau:

Bảng 3.1 Số lượng trại khảo sát và số mẫu dự kiến

Huyện

Số trại dự kiến khảo sát (trại)

Số vịt dự kiến lấy trong mỗi trại (con)

Tổng số vịt lấy mẫu (con)

Giai đoạn tuổi (tuần)

Trảng Bom

20

2 - 5

120 - 300

0 - 8

Gia Kiệm

20

Thống nhất

20


* Bố trí lấy mẫu mổ khám theo tuổi vịt

Các mẫu vịt được chúng tôi bố trí thu thập để mổ khám theo các lứa tuổi như sau: < 2 tuần, 2-4 tuần, 4-6 tuần, 6-8 tuần.



* Phương pháp mổ khám và thu thập mẫu

Mẫu vịt thu thập sẽ được chúng tôi tiến hành mổ khám tại chỗ hoặc đưa vịt (còn sống hoặc chết không quá 5 giờ) về phòng mổ khám, Bệnh viện Thú y trường đại học Nông Lâm TP.HCM. Chúng tôi tiến hành mổ khám vịt theo phương pháp mổ khám toàn diện của ngành thú y - Cục Thú y (2006).



Chuẩn bị mổ khám

Chuẩn bị đầy đủ các dụng cụ mổ khám đã được vô trùng, hóa chất và trang thiết bị bảo hộ cho người mổ khám.



Tiến hành mổ khám

Quan sát từ ngoài vào trong, kiểm tra từng cơ quan riêng biệt, ghi lại các biểu hiện vào biên bản mổ khám. Tiến hành mổ khám theo trình tự như sau: nếu vịt còn sống, cắt đứt tĩnh mạch cổ hoặc hủy não cho vịt chết. Đặt vịt nằm ngửa trên bàn mổ, dùng kéo cắt da giữa vùng bụng và vùng bẹn hai bên chân rồi lật chân sang một bên. Cắt da vùng giữa lỗ huyệt và xương lưỡi hái lên đến tận diều bộc lộ vùng cơ ngực. Kiểm tra tình trạng khô cơ, xuất huyết cơ đùi, cơ ngực và xương lưỡi hái. Sau đó, dùng kéo rọc da từ phần mỏ ác lên tới tận mỏ bộc lộ diều, khí quản, tuyến ức để kiểm tra bên ngoài. Cắt ngang phần cơ giữa lỗ huyệt và xương lưỡi hái, cắt tiếp lên phía trên hai bên sụn qua xương đòn, xương mỏ quạ, loại những tổ chức dính. Bỏ xương lưỡi hái ra ngoài để bộc lộ xoang ngực, xoang bụng. Đến đây ta có thể quan sát các cơ quan nội tạng của vịt.

Các mẫu bệnh phẩm này được cho vào các túi nylon vô trùng, riêng cho từng xét nghiệm. Mẫu được bảo quản ngắn ở -8 0C cho đến khi tiến hành xử lý. Cơ quan mẫu thu thập cho các xét nghiệm được trình bày chi tiết qua bảng 3.2.

Bảng 3.2 Mẫu thu thập cho các nghiên cứu xét nghiệm bệnh


Chẩn đoán

Circovirus

RA

Cơ quan lấy mẫu

Gan, túi bursa fabricius

Não, swab lỗ huyệt hoặc hầu họng


3.4.1.3 Ứng dụng kỹ thuật PCR để chẩn đoán Circovirus trên vịt

(bổ sung sau)

3.4.1.4 Chỉ tiêu theo dõi

Tỷ lệ nhiễm DuCV trên vịt theo địa phương = (số mẫu cho kết quả PCR (+) với Circovirus theo địa phương/Tổng số mẫu xét nghiệm Circovirus theo địa phương) x 100

Tỷ lệ nhiễm DuCV trên vịt theo lứa tuổi = (Số mẫu cho kết quả PCR (+) với Circovirus theo lứa tuổi/Tổng số mẫu xét nghiệm theo lứa tuổi) x 100

3.4.2 Đánh giá mức độ đồng nhiễm Circovirus với RA

Để xác định tỷ lệ nhiễm RA trên mẫu nghiên cứu, chúng tôi tiến hành nuôi cấy, phân lập RA và khẳng định lại kết quả nuôi cấy bằng kỹ thuật PCR.



3.4.2.1 Nuôi cấy, phân lập RA

3.4.2.1.1 Vật liệu và hóa chất nghiên cứu

Đĩa thạch máu cừu 5 % (Hanil Komed, Seongnam, South Korea)

CO2 5 %

Kit API 20E (Bio Merieux, Marcy-I’Etoile, France) gồm: bộ test + thuốc thử (TDA-Tryptophane DeAminase, IND-INDole production, VP-Voges Proskauer) và các vật dụng cơ bản trong phòng nuôi cấy.



3.4.2.1.2 Nguyên liệu

Não vịt


Mẫu swab hầu họng

Mẫu swab lỗ huyệt



3.4.2.1.3 Phương pháp nuôi cấy

Đồng nhất mẫu mô não trước khi ủ cấy trong đĩa thạch máu cừu 10 % và ủ ở 37 0C trong CO2 5% trong 48 giờ (hoặc mẫu swab hầu họng, lỗ huyệt được nuôi cấy trong thạch máu ở 37 0C trong 24 giờ). Các khuẩn lạc gram âm đặc trưng (đường kính 1-2 mm, mặt lồi, trong suốt, long lanh) được nuôi cấy lần 2 trong thạnh máu cừu 5 %. Tiến hành nhuộm Gram cho các khuẩn lạc điển hình. Sau đó, các khuẩn lạc gram (-) được xác định bằng kit API 20E.



3.4.2.2 Ứng dụng kỹ thuật PCR chẩn đoán RA (Manju và cs, 2014)

Các mẫu xét nghiệm RA sẽ được khẳng định chính xác lại bằng kỹ thuật PCR.



* Dụng cụ và hóa chất dùng cho phản ứng PCR

- Dụng cụ: Tủ cấy vô trùng, máy ly tâm, tủ -70 0C, -20 0C, tủ lạnh, tủ trữ mẫu và hóa chất, máy PCR, máy vortex, bộ nguồn và bồn điện di, lược gel, khuôn đổ gel, micropipet, đầu tuýp và effendorf, máy luân nhiệt, máy đọc gel, máy đo OD…

- Hóa chất

Hóa chất dùng trong phản ứng PCR: Master mix gồm các thành phần:  Taq DNA Polymerase, PCR Buffer (MgCl2, KCl, Tris-HCl) and dNTPs.

Hóa chất dùng trong điện di: Dung dịch đệm TBE 10X (Promega), agarose (promega), ladder 100 kp (Promega), ethidium bromide (Invitrogen).

* Nguyên liệu

Mẫu: môi trường nuôi cấy chứa khuẩn lạc RA

Đối chứng dương: ?

Đối chứng âm: nước sạch không chứa DNA mẫu

* Phương pháp nghiên cứu

Tách chiết DNA

DNA mẫu được ly trích từ môi trường nuôi cấy chứa khuẩn lạc RA bằng phương pháp ly giải nhiệt. Môi trường mẫu tinh khiết được cho vào 5 ml dung dịch PBS đem ly tâm 3000 vòng/ 10 phút ở 40C, ống mẫu được rửa 2 lần trong PBS. Sau đó, mẫu được pha loãng 3 lần trong 100 µl nước cất. Dung dịch được đun sôi 10 phút và làm lạnh trong nước đá 30 phút. Sau khi ly tâm 3000 vòng/ 10 phút ở 4 0C, dung dịch nổi được lọc ra và sử dụng như DNA mẫu.



Phản ứng PCR

Trong nghiên cứu này, chúng tôi sử dụng cặp mồi theo hướng dẫn của Manju và cộng sự (2014) với Taq DNA polymera (Takara Biotechnology Co., Ltd) và chu trình nhiệt được trình bày qua bảng.



Bảng 3.3 Trình tự đoạn mồi dùng trong phản ứng PCR chẩn đoán RA

Mồi

Trình tự đoạn mồi

(5’-3’)

Sản phẩm PCR (bp)

Tài liệu tham khảo

Mồi xuôi

TTACCGACTGATTGCCTTCTAG

546


Manju và cs (2014)

Mồi ngược

AGAGGAAGACCGAGGACATC

Manju và cs (2014)

Bảng 3.4 Thành phần phản ứng PCR trong chẩn đoán RA



Thành phần

Thể tích ((µl)

Nồng độ cuối

DNA mẫu

5




Master mix

20




Taq DNA polymerase







Mồi xuôi




20 pm

Mồi ngược




20 pm

dNTP




200 µM

PCR buffer

+ KCl


+ Tris-HCl

+ MgCl2






50 Mm

10 Mm


1,5 mM




Thêm nuclear free water để đạt tổng thể tích 25µl


Bảng 3.5 Chu trình luân nhiệt phản ứng PCR phát hiện RA

Giai đoạn

Nhiệt độ (0C)

Thời gian

Số chu kỳ

Tiền biến tính

95

4 phút

1

Biến tính

95







Bắt cặp

55

1 phút

35

Kéo dài

72







Kéo dài cuối cùng

72

7 phút

1


Điện di sản phẩm PCR

Sản phẩm PCR từ thí nghiệm được điện di trên gel agarose 1 %. Đun sôi bằng lò viba ở 550 W trong 3 phút để agarose tan đều. Để nguội đến 50-55 0C, chuẩn bị khuôn và đổ agarose vào khuôn. Chờ 30 phút để agarose đông. Đặt gel vào buồng điện di. Cho TBE 10X ngập gel. Đặt mẫu vào giếng với tỷ lệ 1,3 µl loading dye và 4 µl sản phẩm PCR. Tiến hành điện di 50 V trong 1 giờ. Sau đó, nhuộm ethidium bromide trong 20 phút. Cuối cùng, rửa gel nhiều lần bằng nước để loại bỏ bớt ethidium bromide dính bên ngoài gel. Chụp hình bằng tia UV và tiến hành đọc kết quả điện di.



3.4.2.3 Chỉ tiêu theo dõi

+ Tỷ lệ nhiễm đơn lẻ Circovirus trên trại khảo sát = Số mẫu cho kết quả PCR (+) của Circovirus/Tổng số mẫu xét nghiệm Circovirus

+ Tỷ lệ nhiễm đơn lẻ Circovirus trên vịt khảo sát = Số mẫu đại diện trại cho kết quả PCR (+) của Circovirus/Tổng số trại xét nghiệm Circovirus

+ Tỷ lệ nhiễm ghép DuCV và RA = Số mẫu nhiễm Circovirus cho kết quả PCR (+) của RA/Tổng số mẫu nhiễm Circovirus đem xét nghiệm RA

+ Tỷ lệ nhiễm RA trên mẫu âm tính với DuCV = Số mẫu âm tính với Circovirus cho kết quả PCR (+) của RA/Tổng số mẫu đem xét nghiệm RA

3.4.3 Xử lý số liệu

Chúng tôi tiến hành xử lý số liệu bằng trắc nghiệm chi-square test (minitab 16) và phần mềm Microsoft Excel 2010.
Каталог: download -> version -> 1443498749 -> module
version -> Phần một MỞ ĐẦu lý do chọn đề tài
version -> Ts. Nguyễn thị HẬu sơ lược lịch sử vương quốc Chămpa
version -> Ature của bồn tắm mưa ảnh hưởng đến cấu trúc sợi và tài sản (167)
version -> Tiểu luận composit gvhd huỳnh Thị Việt Hà
version -> Một số KỸ NĂng cơ BẢn trong lãnh đẠO, quản lý CỦa cán bộ LÃnh đẠO, quản lý Ở CƠ SỞ Cách thức làm bài chung
version -> Hướng dẫn tìm cực nhanh mọi thứ bằng Google
version -> Bảng 17. Điển hình thuộc tính của sợi Acrylic
version -> ĐÁi tháo nhạT
module -> Ứng dụng kỹ thuật pcr trong chẩN ĐOÁn circovirus trên vịt và ĐÁnh giá TỶ LỆ nhiễm ghép giữa ducv và riemerella anatipestifer trên các giống vịt siêu thịt nhập ngoạI

tải về 1.26 Mb.

Chia sẻ với bạn bè của bạn:




Cơ sở dữ liệu được bảo vệ bởi bản quyền ©tieuluan.info 2022
được sử dụng cho việc quản lý

    Quê hương